Introducing Neo4j Workspace We’re inviting you to check out Neo4j Workspace. Workspace combines our most powerful graph tools (Data Importer, Bloom, and Browser) all in one place to help you get up and running with graph databases faster. For experie...
The Neo4j Graph Platform includes the core database and all the technologies surrounding the database, making it useful and accessible for a lot of different users. When asking a question, please select a descriptive label that best matches your quer...
LOAD CSV WITH HEADERS FROM 'https://github.com/aravind-sundaresan/Graph-ML-Fraud-Detection/blob/master/data/bs140513_032310.csv' AS line WITH line, SPLIT(line.customer, "'") AS customerID, SPLIT(line.merchant, "'") AS merchantID, SPLIT(line.age, "'")...
Hi , I am trying to sync oracle and neo4j database . Ran call apoc.load.driver('oracle.jdbc.driver.OracleDriver'); to load the driver but its giving below error Neo.ClientError.Procedure.ProcedureCallFailed: Failed to invoke procedure apoc.load.driv...
I have a sequence string 'TTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCT' I have nodes with the label Sequence and property seqFull which contains a large DNA String. Want to return the nodes and the similarity score where the...
Desktop 1.3.8 I have successfully loaded from Oracle tables Oracle schema is snowflake : fact > dim_account -> dim_customer I want to pre-join account and customer on oracle side (in a view) then load that into neo4j NB I am new to neo4j/graph databa...
Hello, I am trying to import file from s3 to neo4j but I am getting error which is Neo.ClientError.Statement.ExternalResourceFailed: Couldn't load the external resource at: ''s3 link" i did the aws configuration as well. Also, I did make the changes ...
Hello all! I hope you guys are doing well and staying safe. I have a quick question regarding storing biometrics in NEO4j. I did research and have not found detailed approach or documents yet. If you guys could share any knowledge, link, used cases o...
I'm not sure what the problem is. When I run this query it creates all the date of birth nodes, and then it creates a [WAS_BORN_ON] relationship to every single member for each date. Any help? LOAD CSV WITH HEADERS FROM "file:///Members.csv" as line ...
Hi Team, How to upgrade from neo4j 3.1.6 to neo4j 3.5.17?
i was trying integrate LDAP to neo4j 3.5. 3.5 documentation says that dbms.security.ldap.authorization.group_to_role_mapping is deprecated, but examples still use them. if so, how do I map LDAP group of an user-login to neo4j role in neo4j 3.5? Thank...
Version: Neo4j Enterprise Edition, 4.1 We use Secure OpenLDAP So I managed to configure LDAPS(i.e. secure LDAP) with Neo. I can log in with LDAP username and password successfully however the user only has the PUBLIC role. I have the dbms.security.ld...
Dear community I have issues with performance of the graph and queries when dealing with many millions of nodes. The goal is probably to be able to handle billions of nodes later after this PoC. I have a larger query which does not perform at since I...
I'm curious as to how Neo4j Bloom was made, as it is one of the best web-based graph visualisers I've come across. I can see that from inspecting the Neo4j Browser that the graph visualisation leverages SVG similarly to D3.js. Is D3.js the library th...
Hi, I need to get all nodes and relationships related to a given node. For example, I have a node "Person", and it's related to node "Family", node "City", node "Car" and node "Bank": Person [PartOf]-> Family Person [BornIn]-> City Person [Own]-> Car...
I need to find intermediate communities. Is it possible to define a community as a node and find out which community is a bridge between other communities?
Hello, We have recently released, then rolled back updates to Neo4j Desktop, versions 1.3.5 and 1.3.6. They have both revealed migration problems stemming from some internal refactoring. The refactoring has revealed gaps in our testing regime, which ...
All the sessions of the conference are now available online
